Arabidopsis CDPKs Subgroup I (10 members)

Please note that:

- SALK snapshots are updated on a monthly basis.

- Information regarding the SAIL/GARLIC lines were based on A. Sessions et. al. (The Plant Cell, Vol. 14, 29852994, December 2002).

- SAIL/GARLIC line insert site features were determined based on published insertion positions and gene feature tables obtained from TAIR.



CPK4 At4g09570
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_283_E11 1452 2624 exon3 3.00E-16 TGGAGCGCCGGTGTTATCTT GTGGAGACTAAAGGGCTACAA
SAIL_187_E08 2739 2624 exon7 0 ACATCGCGGAGCTTAAAATCG GTGTTGGGAGGAGCAGAACT
CPK6(3) At2g17290
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_690_H07 373 2459 intron1 0 ACTCGCAACTAACGCTTACCT CCCATTATGCGGCGTAACGT
SAIL_690_H07 373 2459 intron1 0 ACTCGCAACTAACGCTTACCT CCCATTATGCGGCGTAACGT
SAIL_181_C09 -567 2459 L300-5' 9.00E-47 TTCTCCCTACTTGCACTAAGTA AAGACAAGAGCTCCTGAAAAGT
SAIL_181_C10 -567 2459 L300-5' 6.00E-45 TTCTCCCTACTTGCACTAAGTA AAGACAAGAGCTCCTGAAAAGT
SAIL_181_C10 -570 2459 L300-5' 3.00E-19 TTCTCCCTACTTGCACTAAGTA AAGACAAGAGCTCCTGAAAAGT
SAIL_181_C09 -567 2459 L300-5' 9.00E-47 TTCTCCCTACTTGCACTAAGTA AAGACAAGAGCTCCTGAAAAGT
SAIL_181_C10 -567 2459 L300-5' 6.00E-45 TTCTCCCTACTTGCACTAAGTA AAGACAAGAGCTCCTGAAAAGT
SAIL_181_C10 -570 2459 L300-5' 3.00E-19 TTCTCCCTACTTGCACTAAGTA AAGACAAGAGCTCCTGAAAAGT
CPK26 At4g38230
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
No KO line available
CPK25 At2g35890
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_1160_A07 -911 1961 L300-5' 6.00E-54 GTAGAGGAGCACCGCAATGA ATTACTCCATGCCACAAAATGG
SAIL_226_B09 -827 1961 L300-5' 1.00E-12 GGTCCCTTTAAACTCCGTAATT CACACTCCTCTGGCGAGATT
SAIL_270_D10 -669 1961 L300-5' 4.00E-55 CTAAGAAGCGTGGGGATTGTA GTCTCACGTCGTGACTGAATT
SAIL_664_G07 -512 1961 L300-5' e-112 TGGTCAAAGTAGAGTGATATGC TCTCGAGGTCGGCTGAATAAT
SAIL_815_E02 -672 1961 L300-5' 0 CTAAGAAGCGTGGGGATTGTA GTCTCACGTCGTGACTGAATT
SAIL_905_C11 -457 1961 L300-5' 9.00E-07 TGGTCAAAGTAGAGTGATATGC GAGACAAAGATCTCTCCTATCT
SAIL_1160_A07 -911 1961 L300-5' 6.00E-54 GTAGAGGAGCACCGCAATGA ATTACTCCATGCCACAAAATGG
SAIL_226_B09 -827 1961 L300-5' 1.00E-12 GGTCCCTTTAAACTCCGTAATT CACACTCCTCTGGCGAGATT
SAIL_270_D10 -669 1961 L300-5' 4.00E-55 CTAAGAAGCGTGGGGATTGTA GTCTCACGTCGTGACTGAATT
SAIL_664_G07 -512 1961 L300-5' e-112 TGGTCAAAGTAGAGTGATATGC TCTCGAGGTCGGCTGAATAAT
SAIL_815_E02 -672 1961 L300-5' 0 CTAAGAAGCGTGGGGATTGTA GTCTCACGTCGTGACTGAATT
SAIL_905_C11 -457 1961 L300-5' 9.00E-07 TGGTCAAAGTAGAGTGATATGC GAGACAAAGATCTCTCCTATCT
CPK11(2) At1g35670
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_835_C07 127 2847 exon1 4.00E-06 AAGCTCACCACCTTCACAAAC AGTTAAAGCAAGATAACTAATCTG
SAIL_835_C07 127 2847 exon1 4.00E-06 AAGCTCACCACCTTCACAAAC AGTTAAAGCAAGATAACTAATCTG
CPK5 At4g35310
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_657_C06 18 2712 5' utr 2.00E-94 GGAATTACCAAATCCTGGTTATA CTCAATCGCCGCCGTAAAATA
SAIL_73_C11 -643 2712 L300-5' 5.00E-64 AAACCAGTTTCTCTTTTGTTTATC TAGGCCTTATTGTAAGGTCTAAA
SAIL_528_D08 -289 2712 R300-5' 1.00E-49 GTCTTCTCATACGACGAGAATA TGAACTCAGAAGGGCGAAAGA
CPK2 At3g10660
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_343_A06 1435 2870 exon3 6.00E-42 GTGGAGTGCTGGTGTGATTG TCTGGAGCCACACCGTCAAT
SAIL_343_A06 1435 2870 exon3 6.00E-42 GTGGAGTGCTGGTGTGATTG TCTGGAGCCACACCGTCAAT
SAIL_1288_C10 2300 2870 exon6 e-140 TTTGCTCTTTTCCTTTACTATGAA CTGCATCATTGCCACAAACTC
SAIL_1288_C10 2300 2870 exon6 e-140 TTTGCTCTTTTCCTTTACTATGAA CTGCATCATTGCCACAAACTC
CPK12(9) At5g23580
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_589_E06 1698 2265 exon5 2.00E-75 TCCTCATCATTGCCACAAATTC TCGGTGGTCTCAAAGAACTGT
SAIL_1263_D01 2022 2265 exon6 1.00E-18 AGAGCTTCAACAGGCATGGAA TAAGCAACTCCTTTGGTTTTTTG
SAIL_44_A06 -1635 2265 L300-5' 8.00E-35 GGCTTAAACCCCTCGCTTTTT GGGTATACAGCTGGAAGGCT
SAIL_44_A06 -1635 2265 L300-5' 1.00E-21 GGCTTAAACCCCTCGCTTTTT GGGTATACAGCTGGAAGGCT
SAIL_1289_E06 -347 2265 L300-5' 9.00E-07 No Good Primer Identified
SAIL_340_F03 -145 2265 R300-5' 2.00E-23 TTTTGAATGCATTGTGCCTTATTA GGCCTTGTCCAAGGACTTGA
SAIL_792_G05 -125 2265 R300-5' 2.00E-07 TTTGGACTCTGGTAGTATATTAC GGCCTTGTCCAAGGACTTGA
SAIL_839_H10 -22 2265 R300-5' 0 TTTTTCCTTCATTCAGTTAAAAGC CTCAGAACGTCGTCGTAATCT
SAIL_857_G12 -274 2265 R300-5' 2.00E-07 ACTATCGCTACAACTACTTCTTT CTGACTTGGAGAAGGCATTGA
CPK1(AK1) At5g04870
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_403_B10 1557 3243 exon2 6.00E-82 AGCGGAGTTCCTCCATTCTG ACTGCTTCATACGGCTCAGAA
SAIL_346_B04 -419 3243 L300-5' 0 GCATCCCCAGATAACAACAAC GTGGGTTTTGTTTGCGCATTTT
SAIL_516_D12 -942 3243 L300-5' 0 TGCGCAAACAAAACCCACATAT CACCAAAAAACGCTGTTGTGAT
SAIL_828_H10 -398 3243 L300-5' 3.00E-65 TAGGACTCCAGAAAGGAAATTG GGGTATCGGAAAAATCATGACT
CPK20 At2g38910
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_351_D04 2148 2269 intron6 e-113 ACATTTGATCAGGCGGATATAG GCAGTAAGCAGCCCATATACA
SAIL_351_D04 2148 2269 intron6 e-113 ACATTTGATCAGGCGGATATAG GCAGTAAGCAGCCCATATACA
SAIL_1271_A07 -1448 2269 L300-5' 2.00E-11 GCTCACTCATAACGACTTCAAA TGCAATCTGCCTCGTAATAAAAA
SAIL_377_G02 -880 2269 L300-5' e-109 TCGTTATGAGTGAGCCTTTCAT TTCTGAAACTTGTGATGTATATAG
SAIL_1271_A07 -1448 2269 L300-5' 2.00E-11 GCTCACTCATAACGACTTCAAA TGCAATCTGCCTCGTAATAAAAA
SAIL_377_G02 -880 2269 L300-5' e-109 TCGTTATGAGTGAGCCTTTCAT TTCTGAAACTTGTGATGTATATAG