Arabidopsis CDPKs Subgroup II (13 members)

Please note that:

- SALK snapshots are updated on a monthly basis.

- Information regarding the SAIL/GARLIC lines were based on A. Sessions et. al. (The Plant Cell, Vol. 14, 29852994, December 2002).

- SAIL/GARLIC line insert site features were determined based on published insertion positions and gene feature tables obtained from TAIR.



CPK34 At5g19360
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_558_E05 -546 2064 L300-5' 6.00E-11 AAGCAGCCTGTCTCTGTATTTT GGAGTTGAGAGCCTCTCATAA
SAIL_604_C05 -724 2064 L300-5' 4.00E-06 GGCACCAGACATCACTTCAAA GATGGGTCAACCTTGAGAGAA
SAIL_R15_H12 -516 2064 L300-5' 4.00E-06 TGATCGGGAGGGACTTTAGG GGAGTTGAGAGCCTCTCATAA
CPK27 At4g04700
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_1220_E01 -1383 1674 L300-5' e-139 No Good Primer Identified
SAIL_61_A09 -63 1674 R300-5' 0 TGGGTTTGGTTCAGATTTTTTAG ATGGTTTTGCAGGCGAATGTC
CPK21 At4g04720
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_729_A02 104 3199 5' utr 4.00E-49 TTTTTCCGTTCCAGAACAAATATT CGTATCTGGATCTCGAACTGA
SAIL_754_E09 2065 3199 intron4 9.00E-10 TACGGCTTCCATGAGTTGCTT GTATAGGACCTCTAGGTCTAAA
SAIL_754_E09 2073 3199 intron4 1.00E-79 GACCTCTAGGTCTAAATAGACT GTGGAAAGTGAAGCCAAGATG
CPK23 At4g04740
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_754_E09 2304 4366 intron4 2.00E-14 TGGTCGTTTACCGAGTAATGC GCTTCAACGAGTTGCTGAACT
SAIL_1247_C12 -1798 4366 L300-5' 0 AGCAAAATGCGGTGGTGACAT GGCGGTCTTCTGTACAAAAGA
CPK29 At1g76040
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_68_H01 274 2624 exon1 6.00E-08 GGCAAATCACAAACACATGAGA AAAGCTCTCCTCCAGAACAGA
SAIL_68_H01 274 2624 exon1 6.00E-08 GGCAAATCACAAACACATGAGA AAAGCTCTCCTCCAGAACAGA
SAIL_51_C09 -280 2624 R300-5' 3.00E-74 GTCCTGCCTACGGACTAGG TGGAGAAGCAAAATCCCATAATT
SAIL_51_C09 -280 2624 R300-5' 3.00E-74 GTCCTGCCTACGGACTAGG TGGAGAAGCAAAATCCCATAATT
CPK9 At3g20410
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_688_A10 2904 2807 exon8 e-130 GTTCTGTACTCAGGCTGTTGT GGGAGATGAACAGTCCAAGAT
SAIL_688_A10 2904 2807 exon8 e-130 GTTCTGTACTCAGGCTGTTGT GGGAGATGAACAGTCCAAGAT
SAIL_529_B09 -137 2807 R300-5' 4.00E-95 TCGTTCTTATCTGACCAGGAAT CCATTTTGCTGTGGCTTCATC
SAIL_529_B09 -137 2807 R300-5' 4.00E-95 TCGTTCTTATCTGACCAGGAAT CCATTTTGCTGTGGCTTCATC
CPK15 At4g21940
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_1056_H11 2347 2834 exon7 e-118 GGCTGATGTAGATGGTAATGG CTCTATCAAGGCTTCTCGATTT
SAIL_1259_A05 -8 2834 R300-5' 2.00E-38 TCACTCGTCTATTCTACATGTAA GTTGTGTTAGAACGTGCTTCTT
SAIL_1284_H09 -295 2834 R300-5' 0 GCTGACGTGGCGGATTGTG ATGTCCCGCCGACATTAACG
CPK3(6) At4g23650
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_120_H09 -229 2618 R300-5' 2.00E-88 GGAGCCATTGCCAGAAAAGC GTCTGTGGCCCATTGTCAAAA
SAIL_234_B06 -249 2618 R300-5' 0 GGAGCCATTGCCAGAAAAGC TGTGGCCCATTGTCAAAAGCT
CPK19 At1g61950
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_1215_F07 342 2529 exon1 e-124 CACTTTGTCTGTCTTCATAAGC ACCAGACATCAGTGGAGAACA
SAIL_1215_F07 342 2529 exon1 e-124 CACTTTGTCTGTCTTCATAAGC ACCAGACATCAGTGGAGAACA
SAIL_1269_B04 1573 2529 intron4 e-124 GTGATTGTACCGCTCTTATCG TGGTTGTCGTGTGCAGAGAC
SAIL_1269_B04 1575 2529 intron4 4.00E-83 GTGATTGTACCGCTCTTATCG TGGTTGTCGTGTGCAGAGAC
SAIL_1269_B04 1573 2529 intron4 e-124 GTGATTGTACCGCTCTTATCG TGGTTGTCGTGTGCAGAGAC
SAIL_1269_B04 1575 2529 intron4 4.00E-83 GTGATTGTACCGCTCTTATCG TGGTTGTCGTGTGCAGAGAC
SAIL_733_H04 -1109 2529 L300-5' 2.00E-14 CTGAGCTGTTGGGCTAATATG CCGTTATTCTGGTTTGACACAA
SAIL_733_H04 -1109 2529 L300-5' 2.00E-14 CTGAGCTGTTGGGCTAATATG CCGTTATTCTGGTTTGACACAA
CPK17 At5g12180
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_552_E09 2334 2187 exon7 7.00E-20 CTCTCTAATGAATCGAGTTCTTA GCATGAATGATGGCAGAGACA
CPK22 At4g04710
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_720_B05 1251 3289 intron4 6.00E-51 AGCCAACCATGGCCTTTGATA AGTGATTGACCCGCTTTTGTC
SAIL_206_F06 1925 3289 intron7 2.00E-14 TCTCCCATACCATGCTCTTTC TCATCATAAGCCACTTCTCTTTA
SAIL_754_E09 2569 3289 intron9 4.00E-06 TGAGGAGTTTTGTACGATGATG GTGGAAAGTGAAGCCAAGATG