Arabidopsis CDPKs Subgroup III (8 members)

Please note that:

- SALK snapshots are updated on a monthly basis.

- Information regarding the SAIL/GARLIC lines were based on A. Sessions et. al. (The Plant Cell, Vol. 14, 29852994, December 2002).

- SAIL/GARLIC line insert site features were determined based on published insertion positions and gene feature tables obtained from TAIR.



CPK8(19) At5g19450
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_245_C06 3118 3092 intron7 1.00E-52 AGAAAGCATTTGAGCCAATGGA TGAGAGAAGGTTCATTGCAATTA
CPK7 At5g12480
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_588_G05 -870 300L-5' 2218 e-117 GCCAAAGCTCTGAGAGGAGA ACTTCCATGAGCAAACTATGCA
SAIL_672_C06 -950 300L-5' 2218 e-138 GAAGCGGGAGAGGATGCAG CACTCTCCTCCGGTCAAATAA
CPK7 At5g12840
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_1163_B01 -675 300L-5' 1814 1.00E-79 CTCGTCCCAGCCCATCACT AACCCTGAGGTGAATTTAATCG
SAIL_143b_A03 -746 300L-5' 1814 7.00E-63 No Good Primer Identified
SAIL_16_A10 -741 300L-5' 1814 e-145 CTTTTAATTGTTTTTGCCAATAGG GACAGCCGGCAGGAATGGA
SAIL_234_B11 -698 300L-5' 1814 e-122 CTCGTCCCAGCCCATCACT CGAACAGAACCAGAGAAGAAG
SAIL_797_D05 -1362 300L-5' 1814 e-130 No Good Primer Identified
CPK33 At1g50700
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_26_C12 1553 2171 exon5 2.00E-41 CACTTACCCACTCCCATCTTT AGGTGGAGAAGCATCGGATAA
SAIL_26_C12 1551 2171 exon5 0 CACTTACCCACTCCCATCTTT AGGTGGAGAAGCATCGGATAA
SAIL_26_C12 1553 2171 exon5 2.00E-41 CACTTACCCACTCCCATCTTT AGGTGGAGAAGCATCGGATAA
SAIL_26_C12 1551 2171 exon5 0 CACTTACCCACTCCCATCTTT AGGTGGAGAAGCATCGGATAA
CPK32 At3g57530
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_750_C08 -1278 2687 L300-5' 0 CAAACAAGACTCAGTCTTTGGT CTTCTACCAACAAATCGATAAAC
SAIL_750_C08 -1278 2687 L300-5' 0 CAAACAAGACTCAGTCTTTGGT CTTCTACCAACAAATCGATAAAC
CPK14 At2g41860
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_318_A05 -1824 2140 L300-5' 2.00E-07 CGGTCCCACGTACGATGATT GCATGCATCGATCCCAAATTG
SAIL_390_B07 -1244 2140 L300-5' 2.00E-94 TGGCGAAAGCGCAGAGGAAA GGTTGCACCGAGCCAAAGTT
SAIL_318_A05 -1824 2140 L300-5' 2.00E-07 CGGTCCCACGTACGATGATT GCATGCATCGATCCCAAATTG
SAIL_390_B07 -1244 2140 L300-5' 2.00E-94 TGGCGAAAGCGCAGAGGAAA GGTTGCACCGAGCCAAAGTT
CPK24 At2g31500
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_1166_D03 -1969 2308 L300-5' 8.00E-35 CTCGGGAGGATTCGAAATGC AGGTTAGTCAAAAACTGTTGGAA
SAIL_1166_D03 -1969 2308 L300-5' 8.00E-35 CTCGGGAGGATTCGAAATGC AGGTTAGTCAAAAACTGTTGGAA
SAIL_372_E03 -290 2308 R300-5' 5.00E-27 ACTTCCCATGGGATTCTCTTTT GTCACTATGAAACCATGTCTTTA
SAIL_372_E03 -290 2308 R300-5' 5.00E-27 ACTTCCCATGGGATTCTCTTTT GTCACTATGAAACCATGTCTTTA
CPK13 At3g51850
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_908_G11 1344 2859 exon3 9.00E-07 GATATCTTCCGTTTAAGAAGTGA TTCCTCTGCCGGATTCTTATAA
SAIL_908_G11 1344 2859 exon3 9.00E-07 GATATCTTCCGTTTAAGAAGTGA TTCCTCTGCCGGATTCTTATAA
SAIL_116_A12 -1493 2859 L300-5' 1.00E-98 CACAAAGCTCTACGGTGTAAAA GTGGTGGACGTTGCAACTAG
SAIL_116_A12 -1493 2859 L300-5' 1.00E-98 CACAAAGCTCTACGGTGTAAAA GTGGTGGACGTTGCAACTAG
CPK10(1) At1g18890
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
No KO line available
CPK30(1a) At1g74740
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_337_G01 -666 2277 L300-5' e-109 CTTCACCAAATCTTTTGGTAGAA AGTTTTAGTCTCTGGTGTTGTAA
SAIL_337_G01 -666 2277 L300-5' e-109 CTTCACCAAATCTTTTGGTAGAA AGTTTTAGTCTCTGGTGTTGTAA
SAIL_291_D02 -208 2277 R300-5' 6.00E-42 CGTCCCCGTGGAGGTTTCT TCTCCCCTTCCACGTAAGCT
SAIL_291_D02 -208 2277 R300-5' 6.00E-42 CGTCCCCGTGGAGGTTTCT TCTCCCCTTCCACGTAAGCT