Arabidopsis CDPKs Subgroup IV (3 members)

Please note that:

- SALK snapshots are updated on a monthly basis.

- Information regarding the SAIL/GARLIC lines were based on A. Sessions et. al. (The Plant Cell, Vol. 14, 29852994, December 2002).

- SAIL/GARLIC line insert site features were determined based on published insertion positions and gene feature tables obtained from TAIR.



CPK28 At5g66210
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
No KO line available
CPK18 At4g36070
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_1266_D06 -29 2688 R300-5' 7.00E-26 TTAACCTTATGAGCTCAAAACTC TATCGGTGGCGACGTAGGTA
CPK16 At2g17890
SALK: click here for updated view
SAIL:
Line IDInsert Site Gene LengthInsert Site Feature E-valueForward PrimerReverse Primer
SAIL_17_F01 644 2742 exon2 9.00E-47 ACCTGGCTAAAATACGATCAAG TGATCGTGTCGCCGTCAAGA
SAIL_17_F01 644 2742 exon2 9.00E-47 ACCTGGCTAAAATACGATCAAG TGATCGTGTCGCCGTCAAGA
SAIL_1306_D11 -633 2742 L300-5' 1.00E-55 AAAAGTGGATCATCCAAATATCC GAGGCGGTGAGTTCATTGATT
SAIL_70_C09 -368 2742 L300-5' 2.00E-91 TGGCCACACATGTCAAAATTAG GGAAATGAGGTTGCCATCGAA
SAIL_70_E09 -368 2742 L300-5' 7.00E-94 TGGCCACACATGTCAAAATTAG GGAAATGAGGTTGCCATCGAA
SAIL_1306_D11 -633 2742 L300-5' 1.00E-55 AAAAGTGGATCATCCAAATATCC GAGGCGGTGAGTTCATTGATT
SAIL_70_C09 -368 2742 L300-5' 2.00E-91 TGGCCACACATGTCAAAATTAG GGAAATGAGGTTGCCATCGAA
SAIL_70_E09 -368 2742 L300-5' 7.00E-94 TGGCCACACATGTCAAAATTAG GGAAATGAGGTTGCCATCGAA
SAIL_234_E05 -344 2742 L300-5' 8.00E-72 TTTTGGCCACACATGTCAAAATT TGCCAGAGGGAGGGAGAGA
SAIL_234_F03 -344 2742 L300-5' 1.00E-36 TTTTGGCCACACATGTCAAAATT TGCCAGAGGGAGGGAGAGA
SAIL_234_F05 -346 2742 L300-5' 3.00E-16 TTTTGGCCACACATGTCAAAATT TGCCAGAGGGAGGGAGAGA
SAIL_234_E05 -344 2742 L300-5' 8.00E-72 TTTTGGCCACACATGTCAAAATT TGCCAGAGGGAGGGAGAGA
SAIL_234_F03 -344 2742 L300-5' 1.00E-36 TTTTGGCCACACATGTCAAAATT TGCCAGAGGGAGGGAGAGA
SAIL_234_F05 -346 2742 L300-5' 3.00E-16 TTTTGGCCACACATGTCAAAATT TGCCAGAGGGAGGGAGAGA